Home About us Editorial board Ahead of print Browse Articles Search Submit article Instructions Subscribe Contacts Login 
  • Users Online: 612
  • Home
  • Print this page
  • Email this page


 
Previous article Browse articles Next article 
SHORT COMMUNICATION
J Res Med Sci 2016,  21:59

Evaluating the role of maternal folic acid supplementation in modifying the effects of methylenetetrahydrofolate reductase (C677T and A1298C) gene polymorphisms in oral cleft children


1 Dentofacial Deformities Research Center, Research Institute of Dental Sciences, Shahid Beheshti University of Medical Sciences, Tehran, Iran
2 Department of Orthodontic, Dental School, Semnan University of Medical Sciences, Semnan, Iran
3 Genetic Research Centre, University of Social Welfare and Rehabilitation Sciences, Tehran, Iran
4 Reproductive Biotechnology Research Center, Avicenna Research Institute, ACECR, Tehran, Iran
5 Department of Pediatric, Dental School, Semnan University of Medical Sciences, Semnan, Iran

Date of Submission31-Aug-2015
Date of Decision13-Nov-2015
Date of Acceptance25-Apr-2016
Date of Web Publication01-Aug-2016

Correspondence Address:
Asghar Ebadifar
Dentofacial Deformities Research Center, Research Institute of Dental Sciences, Shahid Beheshti University of Medical Sciences, Tehran
Iran
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/1735-1995.187307

Rights and Permissions
  Abstract 

Background: We studied the role of maternal folic acid supplementation in modifying the effects of methylenetetrahydrofolate reductase (MTHFR C677T and A1298C) gene polymorphisms in Iranian children with oral clefts. Materials and Methods: Forty-seven newborn infants with orofacial cleft and their mothers were selected randomly. Mothers were matched regarding dietary folate intake. The genotyping on venous blood was carried out. Consistency between maternal and child genotypes was analyzed. Results: Genotype consistency was not statistically significant in both C677T and A1298C gene variants (P > 0.05). Conclusion: Maternal folic acid consumption may not have any significant effect on modifying C677T and A1298C polymorphisms in children.

Keywords: Folic acid supplementation, methylenetetrahydrofolate reductase gene, orofacial clefts, polymorphism


How to cite this article:
Ebadifar A, Ameli N, KhorramKhorshid HR, Kamali K, Zeinabadi MS. Evaluating the role of maternal folic acid supplementation in modifying the effects of methylenetetrahydrofolate reductase (C677T and A1298C) gene polymorphisms in oral cleft children. J Res Med Sci 2016;21:59

How to cite this URL:
Ebadifar A, Ameli N, KhorramKhorshid HR, Kamali K, Zeinabadi MS. Evaluating the role of maternal folic acid supplementation in modifying the effects of methylenetetrahydrofolate reductase (C677T and A1298C) gene polymorphisms in oral cleft children. J Res Med Sci [serial online] 2016 [cited 2021 Dec 4];21:59. Available from: https://www.jmsjournal.net/text.asp?2016/21/1/59/187307


  Introduction Top


Orofacial clefts are common malformations involving the maxillofacial structure. In general, Asian or Amerindian populations have the highest birth prevalence, often as high as 1/500. [1]

Multiple genes are associated with nonsyndromic orofacial clefts. [2] The role of folate deficiency as a risk factor for orofacial clefts is important. Genes involved in the folic acid metabolism could also be associated with the risk of development of oral clefts. Since embryonic tissues require a high amount of DNA production and folic acid is needed for DNA synthesis, any event which reduces the supply of folic acid can theoretically result in orofacial clefts. [3]

Methylenetetrahydrofolate reductase (MTHFR) located on the short arm of chromosome 1 is one of these genes. Two of the MTHFR polymorphic variants C677T (locus; rs1801133) and A1298C (locus; rs1801131) are the most important ones in patients with cleft lip and palate. [4]

Low folate concentrations in association with a reduced MTHFR enzyme activity result in an increase in the homocysteine levels and a decrease in plasma methionine which could be related to DNA-methyltransferase inhibition and DNA hypomethylation. [5]

Folic acid supplements during early pregnancy may reduce the risk of oral clefts by about 33% [6] though controversy exists.

A study in Brazil suggested that high-dose (4 mg) folic acid supplements taken by pregnant women could decrease their chance of having the second affected child with orofacial clefts significantly. [7]

The aim of this study was to evaluate the presence of genotype consistency of MTHFR (C677T and A1298C) between children with oral cleft and their mothers and the role of folic acid supplementation on modifying the gene expression.


  Materials and methods Top


In this case-control study, we included 47 patients with nonsyndromic cleft palate and their mother from Mofid Hospital in Tehran, Iran, in 2012-2013. Ethical approval and informed consent were obtained.

Mothers were asked to complete a questionnaire about history of folate intake during periconceptional period (from 3 months prior to 1 month after conception). A food frequency questionnaire was used to select mothers who were matched regarding dietary folate. Questions consisted of dosage, duration, and frequency of supplementary folate intake. [8] Peripheral venous blood was taken for DNA extraction.

Genotyping for C677T and A1298C gene mutations was performed by enzymatic restriction digestion of polymerase chain reaction (PCR) products with HinfI and MboII (New England Biolabs Inc., CA, USA), respectively .

For screening 677C-T and 1298A-C variants in the MTHFR gene, exon 4 and 7 of the gene were amplified by PCR with the use of modified primers (4F: 5'-TCTTCATCCCTCGCCTTGAAC-3'; 4R: 5'-AGGACGGTGCGGTGAGAGTG-3') and (7F: 5' CTTCTACCTGAAGAGCAAGTC 3' 7R: 5'-CATGTCCACAGCATGGAG-3'), respectively. DNA fragments were separated and visualized by electrophoresis using 8% polyacrylamide gels. The wild product of MboII enzyme for A1298C genotype included 176 bp while PCR products for C677T genotype were 198 bp.

Statistical analysis

Data were analyzed by SPSS 11.5 (SPSS Inc., Chicago, USA). Fisher's exact test and Chi-square test were used for analysis. P <0.05 was assumed as statistically significant.


  Results Top


Forty-four (23 females and 21 males) and 47 (25 females and 22 males) newborn samples were available for C677T and A1298C analysis, respectively.

In C677T and A1298C groups, 29 and 26 mothers reported the history of using folic acid supplementation during pregnancy, respectively. Allelic and genotypic frequency in children and their mothers are shown in [Table 1].
Table 1: Allelic and genotypic frequency of C677T and A1298C among cleft children and their mothers

Click here to view


As it is demonstrated in [Table 2], genotype consistency between mothers and children was not statistically significant for the C677T and A1298C variants in both negative and positive history groups (P > 0.05). Thus, maternal history of folic acid consumption may not have any significant effect on modifying C677T and A1298C polymorphisms in children.
Table 2: Genotype consistency of A1298C and C677T between orofacial patients and their mothers according to the history of acid folic supplementation

Click here to view



  Discussion Top


Orofacial cleft is a major public health concern in many countries. In the present study, we concluded that maternal folic acid supplementation did not have a major role in modifying the genotype of MTHFR gene.

MTHFR single nucleotide polymorphism (SNP) C677T was the first common MTHFR variant found and was shown to reduce enzyme activity in both heterozygous and homozygous mutated forms. [9] Another common variant A1298C reduces enzyme activity only in homozygous mutant CC form. The 677 heterozygous computed tomography/homozygous TT significantly reduces enzyme activity since SNP is in the catalytic domain of the enzyme. In addition, it has shown to cause hyperhomocysteinemia, especially if folate deficiency is also present. A1298C only reduces the enzyme activity less than C677T since SNP is located in the presumed regulatory domain of MTHFR and not associated with hyperhomocysteinemia unless concomitant MTHFR C677T variant is also present. There is a significant role of MTHFR SNP C677T in the causation of several major congenital malformations including orofacial clefts. [10]

Mills et al. evaluated the role of polymorphisms of different genes related to folate metabolism in cleft lip and palate. Results showed that no significant relationship exists between MTHFR C677T polymorphism and cleft lip and palate. However, the authors recommended additional investigations to prove the validity of their results. [11]

Another study has shown that maternal C677T is a protective genotype for orofacial clefts, and this protective effect was higher when mothers did not take folic acid supplements. Hence, there is a possibility that folate has no protective effect against orofacial clefts. However, the authors mentioned that more studies with improved power and sample sizes were needed. [12]

Semiç-Jusufagiç et al. reported that low dietary folate intake during the first trimester of pregnancy along with maternal TT genotype could have a damaging impact on the embryonic organogenesis. [13]

A recent meta-analysis performed by Zhao et al. revealed that 677T variant of MTHFR population. However, no significant relationship between MTHFR A1298C polymorphism and nonsyndromic cleft lip with or without cleft palate was found in this meta-analysis. [14]

According to the difficulty of collecting sufficient blood sample from newborn infants, we try to increase the sample size in the next phase.

Acknowledgments

This study is the result of the thesis performed by Dr. Nazila Ameli for her postgraduate degree in orthodontics under Dr. Ebadifar supervision and granted by Dentofacial Deformities Research Center, Research Institute of Dental Sciences, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Financial support and sponsorship

Nil.

of interest


There are no conflicts of interest.


  Authors Contribution Top


  • AE coordinated the study and carried out the design and prepared the manuscript.
  • NA prepared the manuscript and provided assistance in sample collection.
  • HRKK coordinated all the experiments,
  • KK coordinated the statistical analysis and participated in the manuscript preparation.
  • MSZ participated in most of the experiments and manuscript preparation.


 
  References Top

1.
Cooper ME, Ratay JS, Marazita ML. Asian oral-facial cleft birth prevalence. Cleft Palate Craniofac J 2006;43:580-9.  Back to cited text no. 1
    
2.
Kerrigan JJ, Mansell JP, Sengupta A, Brown N, Sandy JR. Palatogenesis and potential mechanisms for clefting. J R Coll Surg Edinb 2000;45:351-8.  Back to cited text no. 2
    
3.
Aydogdu A, Haymana C, Baskoy K, Durukan AH, Ozgur G, Azal O. Combined choroidal neovascularization and hypopituitarism in a patient with homozygous mutation in methylenetetrahydrofolate reductase gene. J Res Med Sci 2014;19:75-9.  Back to cited text no. 3
    
4.
Botto LD, Yang Q. 5,10-Methylenetetrahydrofolate reductase gene variants and congenital anomalies: A HuGE review. Am J Epidemiol 2000;151:862-77.  Back to cited text no. 4
    
5.
Melnyk S, Pogribna M, Pogribny IP, Yi P, James SJ. Measurement of plasma and intracellular S-adenosylmethionine and S-adenosylhomocysteine utilizing coulometric electrochemical detection: Alterations with plasma homocysteine and pyridoxal 5′-phosphate concentrations. Clin Chem 2000;46:265-72.  Back to cited text no. 5
    
6.
Jacques PF, Bostom AG, Wilson PW, Rich S, Rosenberg IH, Selhub J. Determinants of plasma total homocysteine concentration in the Framingham Offspring cohort. Am J Clin Nutr 2001;73:613-21.  Back to cited text no. 6
    
7.
Wehby GL, Félix TM, Goco N, Richieri-Costa A, Chakraborty H, Souza J, et al. High dosage folic acid supplementation, oral cleft recurrence and fetal growth. Int J Environ Res Public Health 2013;10:590-605.  Back to cited text no. 7
    
8.
Pirouzpanah S, Taleban FA, Sabour S, Mehdipour P, Atri M, Farrin N, et al. The biomarker-based validity of a food frequency questionnaire to assess the intake status of folate, pyridoxine and cobalamin among Iranian primary breast cancer patients. Eur J Clin Nutr 2014;68:316-23.  Back to cited text no. 8
    
9.
Goyette P, Pai A, Milos R, Frosst P, Tran P, Chen Z, et al. Gene structure of human and mouse methylenetetrahydrofolate reductase (MTHFR) Mamm Genome 1998;9:652-6.  Back to cited text no. 9
    
10.
Schneider JA, Rees DC, Liu YT, Clegg JB. Worldwide distribution of a common methylenetetrahydrofolate reductase mutation. Am J Hum Genet 1998;62:1258-60.  Back to cited text no. 10
    
11.
Mills JL, Molloy AM, Parle-McDermott A, Troendle JF, Brody LC, Conley MR, et al. Folate-related gene polymorphisms as risk factors for cleft lip and cleft palate. Birth Defects Res A Clin Mol Teratol 2008;82:636-43.  Back to cited text no. 11
    
12.
Jugessur A, Wilcox AJ, Lie RT, Murray JC, Taylor JA, Ulvik A, et al. Exploring the effects of methylenetetrahydrofolate reductase gene variants C677T and A1298C on the risk of orofacial clefts in 261 Norwegian case-parent triads. Am J Epidemiol 2003;157:1083-91.  Back to cited text no. 12
    
13.
Semiç-Jusufagiç A, Bircan R, Çelebiler Ö, Erdim M, Akarsu N, Elçioglu NH. Association between C677T and A1298C MTHFR gene polymorphism and nonsyndromic orofacial clefts in the Turkish population: A case-parent study. Turk J Pediatr 2012;54:617-25.  Back to cited text no. 13
    
14.
Zhao M, Ren Y, Shen L, Zhang Y, Zhou B. Association between MTHFR C677T and A1298C polymorphisms and NSCL/P risk in Asians: A meta-analysis. PLoS One 2014;9:e88242.  Back to cited text no. 14
    



 
 
    Tables

  [Table 1], [Table 2]


This article has been cited by
1 3D light-sheet assay assessing novel valproate-associated cardiotoxicity and folic acid relief in zebrafish embryogenesis
Seoyoung Ki,Seung-Hae Kwon,Juneyong Eum,Ahmed A. Raslan,Kil-Nam Kim,Byung Joon Hwang,Yun Kee
Chemosphere. 2019; 227: 551
[Pubmed] | [DOI]



 

Top
Previous article  Next article
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
Abstract
Introduction
Materials and me...
Results
Discussion
Authors Contribution
References
Article Tables

 Article Access Statistics
    Viewed1452    
    Printed23    
    Emailed0    
    PDF Downloaded122    
    Comments [Add]    
    Cited by others 1    

Recommend this journal